Figure 1: The relationship between inhibition concentration (mM) and absorbance of nine different samples obtained from doing inhibition assays of the enzyme YopH.
Figure 2: Spectra result of the first run of inhibition assay of YopH using inhibitor 5250098 of the Chem Bridge Library. The absorbance was measured at 410nm.
Figure 3: Spectra result of the second run of inhibition assay of YopH using inhibitor 5250098 of the Chem Bridge Library. The absorbance was measured at 410nm.
Enzyme assay - 12/5/2013
Figure 1: Relationship between the enzyme concentration (uM) and the absorbance of five different samples obtained from doing enzyme assays on the enzyme YopH.
Figure 2: Spectra result of enzyme assay on YopH. The absorbance was measured at 410nm.
Characterization of YopH - 12/5/2013
Figure 1: Protein characterization for yopH.
Lane 1: SKIP
Lane 2: the molecular weight standard ladder
Lane 3: cell lysate before induction
Lane 4 : cell lysate after induction
Lane 5: soluble fraction
Lane 6: flow through sample
Lane 7: wash sample
Lane 8: elution 1
Lane 9: elution 2
Purification of YopH - 12/3/2013
The YopH enyme that was expressed was purified using the affinity tag and the Ni-NTA resin.
Figure 1: Elution 1 of YopH after doing purification.
Figure 2: Elution 2 of YopH after doing purification.
Expression of YopH - 11/21/2013
The YopH enzyme was transformed into BL21(DE3) cells in order to be expressed.
Figure 1: YopH, LB, and Kan solution resuspended pellet in lysis buffer after expression
Weight of pellet: 1.47g
Measuring OD values - 23uL of total culture Time Abs at 600nm 9:53 .086 10:29 .075 11:00 .099 12:09 .28 12:34 .36 12:46 .385 1:07 .47 1:12 .47 1:20 .52
From TbPP2A to YopH - 11/21/2013
After several attempts of cloning, a positive clone of Trypanosoma brucei PP2A was not obtained. As a result, we have to move towards the surrogate enzyme YopH. Expression, purification, and characterization will be done on this enzyme. In addition, different concentration of the YopH enzyme will be tested in enzyme assays.
Week 11 & 12
Ligand Preparation - 11/14/2013
The protocol of Ligand preparation was completed in order to make the ligands ready to be screened. The CB-kit_UT.sdf library is currently being screened through GOLD on the homology model of T. brucei PP2A.
Blast Nucleotide Comparisons for Miniprep samples (fourth time) - 11/12/2013
After receiving the DNA sequences of the 18 samples sent to DNA sequencing, a blast nucleotide comparison was done. The two sequences compared were the one of T. Brucei PP2A with each of the the cloning attempts of Tb PP2A (eight samples). All of these blast comparisons showed no similarity. Most of these sequences contained a lot of N's and they were really short. In addition, an email from dfscore was received saying that there might be something wrong with the primers that were used. As a result, few of these samples will be sent again to DNA sequencing using other pLIC-forward and reverse primers in order to know if these are positive clones or not.
DNA Sequencing - 11/8/2013
All the samples obtained from mini-prep, except number 9, were sent to DNA sequencing with pLIC-forward and pLIC-reverse
Figure 1: Order of DNA sequencing.
Mini Prep - 11/8/2013
Mini prep was done on the nine pellets obtained from the nine transformation tubes from the second master plate (the one with 3 ul accepting vecot & 5 ul of insert). Instructions for this step were done following the manual in the miniprep kit. All of the samples were eluted with 50 ul of water and the concentrations for these samples are shown below.
Figure 1: Concentration of tube 1 after doing miniprep.
Figure 2: Concentration of tube 2 after doing miniprep.
Figure 3: Concentration of tube 3 after doing miniprep.
Figure 4: Concentration of tube 4 after doing miniprep.
Figure 5: Concentration of tube 5 after doing miniprep.
Figure 6: Concentration of tube 6 after doing miniprep.
Figure 7: Concentration of tube 7 after doing miniprep.
Figure 8: Concentration of tube 8 after doing miniprep.
Figure 9: Concentration of tube 9 after doing miniprep.
Spin down samples - 11/7/2013
Samples were spun down at 6000 rpm for 10 minutes at 4 C. Supernatant was removed. Samples from the 9 tubes of the master plate containing colonies of 3 ul of accepting vector and 5 ul of insert will be used to do mini-prep. On the other hand, the pellets obtained from the transformation tubes of the plate with 2 ul of accepting vector and 4 ul of insert were stored at -20 C.
Master plate - 11/5/2013
Two master plates were prepared with 9 colonies from each of the transformation plates done on 11/4/2013. The transformation tubes were also prepared. However, there was an error made on this step. Instead of adding 5 ml of LB and 5 ul of Kanamycin to each tube, 5 ml of LB and 5 ul of Ampicillin were added to each tube. As a result, no bacteria grew on the tubes, but it still grew on the master plates since it contained Kanamycin. The transformation tubes were prepared again using the colonies from the master plates.
Figure 1: Master plate with 9 colonies containing 2 ul of T4-treated accepting vector and 4 ul of T4-treated insert.
Figure 2: Master plate with 9 colonies containing 3 ul of T4-treated accepting vector and 5 ul of T4-treated insert.
Plates were moved from 37C incubator to 4C fridge - 11/5/2013
The two plates of the annealing and the transformation step were on the 37 C incubator for a day. Then, they were moved to the 4 C fridge.
Annealing and transformation - 11/4/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 4ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 5 ul of each T4-treated insert. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the plates were incubated upside down at 37 C for one day.
Figure 1: LB-Agar plate with 50 ug/uL Kanamacyn, 5% sucrose, 2 ul of T4-treated accepting vector, and 4 ul of T4-treated insert after one day of incubation at 37 C.
Figure 2: LB-Agar plate with 50 ug/uL Kanamacyn, 5% sucrose, 3 ul of T4-treated accepting vector, and 5 ul of T4-treated insert after one day of incubation at 37 C.
Week 9 & 10
Jacky: Good job explaining the steps and analyzing! Keep up the good work! -Suman
Preparation of the ligands - 10/29/2013
Since it is best to protonate the ligands and generate alternative ionization and tautomeric states, the control ligands were prepared. These ligand preparation methods applied a Force Field to each atom and subsequently carried out an Energy Minimization process to put the ligand in a low energy conformation that is more probable as a starting point in solution. These ligands will then be used for docking our protein.
Positive and negative controls for PP2A - 10/28/2013
11 positive controls were found through the literature of 2NPP, the PDB structure that was used to make our homology model, and through other PDB structures that are very similar to our target, Tb.PP2A. The negative controls were found using Chembridge website and similar properties as the known inhibitors of PP2A like microcystin.
Transformation plates after being incubated at 37 C - 10/24/2013
Figure 1: LB-Agar plate with 50 ug/uL Kanamacyn, 5% sucrose, 3 ul of T4-treated accepting vector, and 6 ul of T4-treated insert.
Figure 2: LB-Agar plate with 50 ug/uL Kanamacyn, 5% sucrose, 2 ul of T4-treated accepting vector, and 8 ul of T4-treated insert.
As it is observed, the plates did not grow as clean of colonies as expected. In an effort to fix this situation, I decided to swipe some of the bacteria from each plate and spread it out on new plates (respectively), in order to regrow the bacteria in better looking colonies. However, one colony from the 2ul T4 treated accepting vector and the 8ul T4 treated insert was picked and chosen to make a master plate.
Annealing and transformation - 10/22/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 8ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 6 ul of each T4-treated insert. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the plates were incubated upside down at 37 C for two days since they did not show colonies the first day.
Week 7 & 8
**Nice work Jacky. Very well organized and analyzed. Do you have any virtual data? -Max 10/21/13
pNIc-Bsa4 preparation as an accepting vector - 10/16/2013
More pNIC-bsa4 was prepared as an accepting vector in order to do another round of cloning to find a positive clone of PP2A.
Figure 1: Successful cut vector for pNIc-BSA4.
PCR clean up - 10/11/2013
PCR clean up was done in Secondary PCR sample 3 obtained on 8/30/2013. Another PCR clean up was done in all of the Secondary PCR samples from 8/30/2013. The Sigma PCR cleanup kit in red box was used for this procedure.
Figure 1: Concentration obtained from doing PCR clean up on PCR squared reaction (trial 1).
Figure 2: Concentration obtained from doing PCR clean up on PCR squared reaction (trial 2).
Note: The concentration obtained from PCR clean up was really good. In addition, the 260/280 and 260/230 values are in the range expected, which shows that the purity of the sample is good. This PCR clean up sample will be used for cloning.
PCR Squared Reaction - 10/11/2013
Eight samples of PCR squared reaction were done using the secondary PCR. An agarose gel was run with these samples to verify that they worked correctly.
Figure 1: Eight samples of PCR squared reaction.
Lane 1: SKIP Lane 2: 100bp DNA ladder Lane 3-10: PCR2 squared reaction
After the plates were incubated upside down at 32 C for one day, there were no colonies in both plates. Therefore, the plates were incubated another day. However, there were still no colonies, and this shows that cloning did not work. As a result, more PCR squared reaction will be done using the same thermocycler conditions as before and then PCR clean up on these samples in order to go into cloning again.
Figure 1: LB-Agar plate with 50 ug/uL Kanamacyn, 5% sucrose, 2 ul of T4-treated accepting vector, and 8 ul of T4-treated insert showing no colonies after two days of incubation at 37 C.
Annealing and Transformation - 10/10/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 8ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 10 ul of each T4-treated insert. More T4-treated insert was added to each tube since we had a low concentration of the PCR sample. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the plates were incubated upside down at 37 C for one day.
Gel extraction on PCR squared reaction - 10/9/2013
A gel was run using all the samples from PCR squared reaction made on 10/4/2013. New TAE was used in order to prevent contamination. For this procedure, the gel was cut were the bands of the gene were shown and then the gel extraction kit was used to follow the procedure of the gel extraction protocol. There were several errors while adding the solutions to the gel and the procedure took longer than what it should take. After finishing this protocol, the concentration of the PCR sample was measured using a nanodrop spectrophotometer. The concentration was not as high as expected and this could be due to the errors made. A picture of the gel before it was cut and the nanodrop images are shown below.
Figure 1: Agarose gel of PCR squared reaction before doing gel extraction.
Lane 1: SKIP Lane 2: 100bp DNA ladder Lane 3-10: PCR2 squared reaction
Positive and negative controls for virtual screening - 10/8/2013
Two positive and one negative control were found. They were run using the GOLD pogram in order to see which one has a higher score. The controls obtained are shown in the table below. However, we still need to find more controls in order to do another run with our protein.
Figure 1: Positive and negative controls that are going to be used to do virtual screening with PP2A.
Week 5 & 6
**Nice Job with keeping your work up to date. Please try to add a more detailed description for your homology model. Thank you. -Max 10/07/2013
PCR Squared Reaction - 10/4/2013
Eight samples of PCR squared reaction were done using the new secondary PCR. This time, we will not use 15ul of these samples in an agarose gel to check if these reactions worked correctly. Instead, we will put all of the samples in the agarose gel and we will do gel extraction. This procedure will be done on Monday 10/7/2013. Then, we will continue with PCR clean up and with cloning to find a postive clone.
Blast Nucleotide Comparisons for Miniprep samples (second time) - 10/4/2013
The eight samples obtained from the second miniprep that was done were sent to DNA sequencing. After receiving the DNA sequences, a blast nucleotide comparison was done. The two sequences compared were the one of T. Brucei PP2A with each of the the cloning attempts of Tb PP2A (eight samples). All of these blast comparisons showed no simmilarity; therefore, they cannot be used for the next step. Another round of cloning will be done and hopefully a positive clone can be found.
Homology Model - 10/3/2013
A homology model was created since protein phosphatase 2A does not have one.
Figure 1: Molprobity Multi-criterion chart of the newly created homology model for PP2A created using 2nppF.
Figure 2: Molprobity Multi-criterion chart of chain F of 2npp
Figure 3: SWISS-MODEL homology test top results.
Figure 4: Blast results to find a homology model for T. Brucei protein phosphatase 2A.
Mini Prep - 9/27/2013
Mini prep was done on the eight pellets obtained from the eight transformation tubes from the second master plate. Instructions for this step were done following the manual in the miniprep kit. This time the samples were eluted with the right amount of water, 50 ul.
Figure 1: Concentration of tube 1 after doing miniprep for the second trial of cloning.
Figure 2: Concentration of tube 2 after doing miniprep for the second trial of cloning.
Figure 3: Concentration of tube 3 after doing miniprep for the second trial of cloning.
Figure 4: Concentration of tube 4 after doing miniprep for the second trial of cloning.
Figure 5: Concentration of tube 5 after doing miniprep for the second trial of cloning.
Figure 6: Concentration of tube 6 after doing miniprep for the second trial of cloning.
Figure 7: Concentration of tube 7 after doing miniprep for the second trial of cloning.
Figure 8: Concentration of tube 8 after doing miniprep for the second trial of cloning.
Note: Most of these samples have really good concentrations and higher than expected; however, the 260/280 and 260/230 values are lower than the average. These values show that the samples are not pure and do not have a good yield.
Secondary PCR - 9/26/2013
Two samples of secondary PCR were done using the same thermocycler cycling conditions that were used the last time it worked.
Figure 1: Two secondary PCR samples with the new and correct primers and Tony's samples.
Lane 1-5: Tony's samples Lane 5: SKIP Lane 6: 100bp DNA ladder Lane 7: primary PCR Lane 8-9: Secondary PCRs (new tail primers)
Blast Nucleotide Comparisons for Mini prep samples - 9/25/2013
Figure 1: Blast nucleotide comparison of DNA sequence of T. Brucei PP2A and cloning attempt of TbPP2A (sample 2 for trial 1) into pNiC-bsa4.
The DNA sequence obtained from sample 2 of mini prep did not show a complete sequence. The Blast nucleotide comparison gave a 30% of query and 99% of identity. As a result, this sample cannot be used for the next step.
Figure 2: Blast nucleotide comparison of DNA sequence of T. Brucei PP2A and cloning attempt of TbPP2A (sample 3 for trial 1) into pNiC-bsa4.
The Blast nucleotide comparison for the DNA sequence of T. Brucei PP2A and the cloning attempt of Tb PP2A (sample 3) gave a 99% of query and a 98% of identity. These percentages are really good. However, since it has a deletion in base pair # 208, it cannot be used for the following step.
Figure 3: Blast nucleotide comparison of DNA sequence of T. Brucei PP2A and cloning attempt of TbPP2A (sample 5 for trial 1) into pNiC-bsa4.
The Blast nucleotide comparison for the DNA sequence of T. Brucei PP2A and the cloning attempt of Tb PP2A (sample 5) gave a 89% of query and a 99% of identity. These percentages are really good. However, since it has two deletions, it cannot be used for the following step.
Figure 4: Blast nucleotide comparison of DNA sequence of T. Brucei PP2A and cloning attempt of TbPP2A (sample 7 for trial 1) into pNiC-bsa4.
The Blast nucleotide comparison for the DNA sequence of T. Brucei PP2A and the cloning attempt of Tb PP2A (sample 7) gave a 93% of query and a 96% of identity. These percentages are really good. However, since it has two deletions, it cannot be used for the following step.
Note: Mini prep will be done again. This time we will use the tubes obtained from the other master plate that was done. In addition, more secondary PCR will be done in order to be prepared for another round of cloning in case this one does not give a positive clone.
Week 3 & 4
Jacky - good work on cloning for this 2 week block. Keep moving it foward though so that we can get your positive clones and move on to the next step. - Dr. B 100113
DNA Sequencing - 9/20/2013
Samples of the miniprep done in tube 2, 3, 5, and 7 were sent to DNA sequencing.
Figure 1: Order for DNA sequencing.
Mini Prep - 9/20/2013
Mini prep was done on the eight pellets obtained from the eight transformation tubes. Instructions for this step were done following the manual in the miniprep kit. However, in the elution step there was an error made. Instead of eluting with 50ul of water or 5mM Tris HCL pH 8.0, all of the samples were eluted with 100 ul of water. This error affected the concentrations of the samples.
Figure 1: Concentration of tube 1 after doing miniprep.
Figure 2: Concentration of tube 2 after doing miniprep.
Figure 3: Concentration of tube 3 after doing miniprep
Figure 4: Concentration of tube 4 after doing miniprep.
Figure 5: Concentration of tube 5 after doing miniprep.
Figure 6: Concentration of tube 6 after doing miniprep.
Figure 7: Concentration of tube 7 after doing miniprep.
Figure 8: Concentration of tube 8 after doing miniprep.
Spin down samples - 9/18/2013
Samples were spun down at 6000 rpm for 10 minutes at 4 C. Supernatant was removed and transformation tubes were stored at -20 C.
Master plate - 9/17/2013
8 colonies from the transformation plate containing the transformation mixture of tube B were grown for about 18 hours in 5 ml of LB with 50 ug/ml Kanamacyn. In addition, a master plate using those colonies was done and incubated at 37 C overnight.
Plates were moved from 37C incubator to 4C fridge - 9/15/2013
The two plates of the annealing and the transformation step were on the 37 C incubator for a day and a half. Then, they were moved to the 4 C fridge.
Annealing and Transformation - 9/13/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 4ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 6ul of each T4-treated insert. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the tubes were incubated upside down at 37 C for about a day and a half.
Preparation of pNIC-Bsa4 as Accepting Vector - 9/13/2013
The preparation of pNIC-Bsa4 as an accepting vector was done by Kevin.
Figure 1: NEB cutter, virtual gel of the cut vector pNIC-Bsa4.
Figure 2: Successful cut vector for pNIc-BSA4 gel.
NOTE: After taking a picture without the rig, the strange imaging at the bottom of the gel disappeared.
PCR clean up - 9/13/2013
PCR clean up was done in Secondary PCR sample 3 obtained on 8/30/2013. Another PCR clean up was done in all of the Secondary PCR samples from 8/30/2013. The Sigma PCR cleanup kit in red box was used for this procedure.
Figure 1: PCR clean up for PCR squared reaction for secondary PCR sample 3 (Trial 1).
Figure 2: PCR clean up for PCR squared reaction for secondary PCR sample 3 (Trial 2).
Figure 3: PCR clean up on PCR squared reaction for all secondary PCR reactions (Trial 1).
Figure 4: PCR clean up on PCR squared reaction for all secondary PCR reactions (Trial 2).
As it is observed in the graphs shown above, the concentration of the PCR clean up done on the PCR2 squared reaction was really low. Therefore, it cannot be used for the next step. However, the concentration of the PCR clean up of all the secondary PCRs samples was really high, which is really good. This sample will be used for the following step.
PCR squared reaction - 9/12/2013
PCR squared was done on Secondary PCR sample 3 obtained on 8/30/2013. The purpose of this step was to make a lot of PCR product since a lot of it will be lost in the PCR cleanup steps. The thermocycler cycling conditions used for this protocol were the same as in Secondary PCR. The only difference was the amount of cycles, which in this case was 30.
Figure 1: PCR2 squared reactions on Secondary PCR sample 3.
Lane 1-2: SKIP Lane 3: 100bp DNA ladder Lane 4-7: PCR2 squared reaction
In order to refresh basic technical and analytical skills of the PyMOL Program, four versions of DHFR were analyzed. Human DHFR was compared to T.cruzi DHFR. This comparison showed that the MTX active sites of both proteins are very similar. On the other hand, when the Human DHFR active site was compared to the T.cruzi TMQ active site, it was found that the two active sites are different. Therefore, the TMQ active site can be targeted specifically, while causing no inhibition of Human DHFR.
Figure 1: 2H2Q protein with chain A shown as green lines and chain B shown as pink lines. NAP substrates are shown as carbon yellow sticks and DU substrates are shown as carbon yellow spheres. Water molecules are shown as small red spheres.
Figure 2: 2H2Q protein with chain A shown as green lines and chain B shown as pink lines. NAP substrates are shown as carbon yellow sticks and DU substrates are shown as carbon yellow spheres. Water molecules are shown as small red spheres. Polar residues are shown in magenta, hydrophobic residues are shown in orange, and ionic residues are shown in blue.
Figure 3: 3CL9 protein shown as sticks with green carbons. NAP shown as sticks in light blue carbons, MTX shown as sticks in magenta carbons, UMP shown as sticks in yellow carbons, EDO shown as sticks in grey carbons, and SO4 shown as sticks in orange carbon. Cl is shown as green spheres. Polar contacts are shown as black dashes. Active site is shown in orange.
Figure 4: 1U72 protein is shown as lines with green carbons. NDP is shown as sticks with blue carbons and MTX is shown as sticks with yellow carbons. Polar contacts are shown as black dashes. The active site is shown as orange and water molecules are shown as red spheres.
Figure 5: Alignment of 1U72 and 3CL9 proteins. Both proteins are shown as lines, 1U72 has light blue carbons and 3CL9 has green carbons. Substrates for 1U72 are shown as sticks; MTX has yellow carbons and NDP has blue carbons. Substrates for 3CL9 are shown as sticks; NAP has light blue carbons, MTX has magenta carbons, UMP has yellow carbons, EDO has grey carbons, and SO4 has orange carbons. Cl is shown as green spheres. Water molecules are shown as red spheres. The active site for 1U72 is shown as dark blue and the active site for 3CL9 is shown as orange.
Figure 6: 3HBB protein with four chains as lines. Chain A has green carbons, Chain B has pink carbon, chain C has blue carbons, and Chain D has orange carbon. Substrates and cofactors are shown as sticks, with NAP in carbon light blue, EDO in carbon yellow, TMQ in carbon peach, and SO4 in carbon grey. Polar contacts are shown as black dashes. Waters molecules are shown as red spheres and the active sites are shown as red sticks.
Secondary PCR - 8/30/2013
Figure 1: Successful Secondary PCR of T. Brucei tail primers
Lane 1: SKIP Lane 2: 100bp DNA ladder Lane 3-10: Secondary PCRs ( new tail primers)
? = Anneanling temperatures used at each lane: Lane 1: 72°C Lane 2: 71.4°C Lane 3: 70.1°C Lane 4:68.3°C Lane 5:66°C Lane 6:64.3°C Lane 7: 63°C Lane 8:62°C
New primers were ordered since the ones that were used during the summer were not order correctly.
Fall 2013
Week 6
Primary PCR and secondary PCR - 7/10/2013
Four samples of secondary PCR were done with the tail primers using different annealing temperatures and different times.
Figure 3: Agarose gel of primary PCR and secondary PCRs.
Lane 1-2: SKIP Lane 3: 100bp DNA ladder Lane 4: Primary PCR Lane 5-8: Secondary PCRs (tail primers)
Primary PCR thermocycler cycling conditions:
Same conditions as the ones used the first time.
Note: PrimaryPCR worked correctly. However, the secondary PCRs did not work.
Primary PCR and secondary PCR - 7/10/2013
Figure 2: Agarose gel of primary PCR and secondary PCRs (Trial 2).
Lane 1-2: SKIP Lane 3: 1kb DNA ladder Lane 4: Primary PCR Lane 5: Secondary PCR (tail primers) Lane 6: Secondary PCR (tail primers)
Primary PCR thermocycler cycling conditions:
Same conditions as the ones used the first time. Secondary PCR thermocycler cycling conditions:
98°C - 30 sec
98°C - 10 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Note: Primary PCR worked correctly. However, both secondary PCRs did not work.
Primary PCR and secondary PCR - 7/9/2013
Another sample of Primary PCR was done using the same conditions as in 7/5/2013. In addition, two samples of secondary PCR were done at two different annealing temperatures using the tail primers.
Week 5
Primary PCR and secondary PCR - 7/5/2013
Figure 1: Agarose gel of primary PCR and secondary PCRs (Trial 1).
Lane 1-3: SKIP Lane 4: 1kb DNA ladder Lane 5: Primary PCR Lane 6: Secondary PCR (first and last primers)
Note: Primary PCR seems to worked correctly since it looks like a smear. However, secondary PCR did not work correctly since the result observed is not in the place where it should be. First and last primers were used. The 100bp ladder should be used instead of the 1kb DNA ladder since the gene is 969 base pairs.
Agarose gel preparation for pLIC (Trial 1) - 7/3/2013
Figure 1: Agarose gel of PCR of PNIC plasmid using pLIC forward and reverse primers.
Lane 1: 100 bp DNA ladder Lane 2: Low concentration sample (0.0362 ng/ul) Lane 3: Medium concentration sample (0.362 ng/ul) Lane 4: High concentration sample (3.62 ng/ul) Lane 5: Control sample (no DNA) Lane 6: Anita's samples
Note: Results shown are correct. Since the 4th lane has a higher concentration, it was expected that it has more amplification and a stronger signal than the other samples.
Restriction Enzyme Digest - 7/3/13
Figure 1: Agarose gel of pGBR22 restriction enzyme digest for the second time.
Lane 1: skip Lane 2: 1 kb DNA ladder Lane 3: Uncut plasmid sample Lane 4: EcoRI Lane 5: PvuII Lane 6: EcoRI & PvuII
Note: This protocol was done for the second time. Digestion reactions were made on 7/2/13 and the agarose gel was done on 7/3/13. The results obtained match the results from the custom digest. However, there are other bands shown, which could be contamination.
Protein characterization for FtHAP - 7/2/2013
Figure 1:Protein Characterization for FtHAP
Lane 1: SKIP Lane 2: Elution 2 Lane 3: Elution 1 Lane 4: Wash Lane 5: Flow through Lane 6: Soluble fraction Lane 7: Cell lysate after induction Lane 8: Cell lysate before induction Lane 9: Molecular weight standard ladder
PCR for pLIC (Trial 1) - 7/2/2013
This protocol was done for the first time. The pNIC plasmid used had a concentration of 36.2 ng/ul. Four samples were prepared. The first one had a concentration of 0.0362 ng/ul. The second one had a concentration of 0.362 ng/ul. The third sample had a concentration of 3.62 ng/ul. The fourth sample did not have the DNA plasmid because it was the control. It is expected that sample 3 shows more amplification since it has the highest concentration.
WEEK 4
Restriction Enzyme Digest - 6/28/2013
DIgestion reactions were made, but the gel will be done on Monday. Digestions are stored in the -20 C freezer.
Figure 1: Agarose gel of pGBR22 restriction enzyme digest for the first time
Lane 1: skip Lane 2: 1 kb DNA ladder Lane 3: Uncut plasmid sample Lane 4: EcoRI Lane 5: PvuII Lane 6: EcoRI & PvuII Lane 7-10: Kevin's samples
Note: Samples were done on 6/28/13, but the gel was done on 7/2/13. Digestion reactions were stored in -20C freezer. Samples did not show up; therefore, protocol has to be redone. The problem seems to be in the pGBR22 plasmid that was used since it did not work for anyone.
Protein Characterization - 6/28/2013
Gel is being washed over the weekend. On Monday, a picture of the gel will be taken and the gel will be dried.
Protein Purification - 6/26/2013
Figure 1: Nanodrop of elution 1 sample from purification of FtHAP protein.
Figure 2: Nanodrop of elution 2 sample from purification of FtHAP protein.
Agarose gel preparation for pGBR22 plasmid (Trial 3) - 6/26/2013
Figure 1: PCR of plasmid pGBR22 for the third time.
Lane 1-5: Kavya's samples for pLIC Lane 6: 1 kb Ladder Lane 7: Sample A, 1:500 template DNA, 1 uL Taq Lane 8: Sample B: 1:500 template DNA, 1 uL Taq Lane 9: Sample C: 1:50 template DNA, 1 uL Taq Lane 10: Sample D: no DNA, 1 uL Taq
Agarose gel preparation for GFP plasmid (Trial 2) - 6/26/2013
Figure 1: PCR of plasmid GFP for the second time.
Lane 1: 100 bp ladder Lane 2: sample 1, 1:100000 template DNA, 1 uL Taq Lane 3: sample 2, 1:10000 template DNA, 1 ul Taq Lane 4: sample 3, 1:1000 template DNA, 1 ul Taq Lane 5: sample 4, no DNA, 1 ul Taq Lane 6: 100 bp ladder Lane 7: sample 5, 1:100000 template DNA, 1 uL Taq Lane 8: sample 6, 1:10000 template DNA, 1 ul Taq Lane 9: sample 7, 1:1000 template DNA, 1 ul Taq Lane 10: sample 8, no DNA, 1 ul Taq
Note: The samples with the primers VDS 1 and 2 did not show any results. The only sources of error are in the temperature used or the PCR machine used since the Taq, buffer, and dNTP were the same ones used for the M13 forward and reverse primers, which showed up on the gel.
Analysis of DNA sequencing of pGBR22 - 6/24/2013
DNA sequence of pGBR22 was analyzed in the computer lab. The forward and reverse primers were determined, as well as the location of the start and stop codon of the specified plasmid and the vector backbone.
WEEK 3
PCR for GFP (Trial 2) - 6/20/2013
This protocol was done for the second time since the first one did not show anything. The primers VDS1 and VDS2 were used for samples 1 through 4 and primers M13 forward and reverse were used for samples 5 through 8. Two PCR machines were used due to the different temperatures needed for the primers in the third step. For VDS2 the temperature used was 53.6 C instead of 55.6 C and for M13 the temperature was 42 C again. One of the PCR machines was used for the first four samples and the other one for the other four samples.
PCR for pGBR22 (Trial 3) - 6/20/2013
This protocol was done for the third time since the results of the first two trials did not work correctly. This time, the primers used were M13 forward and reverse instead of SP6/T7. Also, a different PCR machine was used.
Protein Expression - 6/17/2013 to 6/19/2013
Day 1: Transformation of FtHAP plasmid into BL21(DE3) cells. Day 2: Overnight cultures. Day 3: Purification of the FtHAP protein.
Agarose gel preparation for GFP plasmid (Trial 1) - 6/18/2013
Figure 1: PCR for plasmid GFP for the first time.
Lane 1: 100 bp ladderLane 2: sample 1, 1:100000 template DNA, 1 uL TaqLane 3: sample 2, 1:10000 template DNA, 1 ul TaqLane 4: sample 3, 1:1000 template DNA, 1 ul TaqLane 5: sample 4, no DNA, 1 ul TaqLane 6: 100 bp ladderLane 7: sample 5, 1:100000 template DNA, 1 uL TaqLane 8: sample 6, 1:10000 template DNA, 1 ul TaqLane 9: sample 7, 1:1000 template DNA, 1 ul TaqLane 10: sample 8, no DNA, 1 ul Taq Note: Samples were not shown. Therefore, PCR must be redone.
Agarose gel preparation for pGBR22 plasmid (Trial 2) - 6/18/2013
Figure 1: PCR of plasmid pGBR22 for the second time
Lane 1: 1 kb Ladder Lane 2: Sample A, 1:500 template DNA, 1 uL Taq Lane 3: Sample B: 1:500 template DNA, 1 uL Taq Lane 4: Sample C: 1:50 template DNA, 1 uL Taq Lane 5: Sample D: no DNA, 1 uL Taq Lane 6-10: Karuna's samples for pGBR22
Note: Samples were not shown. Therefore, PCR must be redone.
DNA Sequencing results for pGBR22 (Midi prep) - 6/17/2013
Note: The blast result shown above showed the identity of the pGBR22 plasmid. Therefore, the plasmid was transferred to the plasmid box.
WEEK 2 - Jacky - good job on the page. I would re-run your PCR of pGBR22. Looks like there are multiple amplification products. -- Dr. B
PCR for GFP (Trial 1) - 6/13/2013
This protocol was done for the first time. The primers VDS1 and VDS2 were used for samples 1 through 4 and primers M13 forward and reverse were used for samples 5 through 8. Two PCR machines were used due to the different temperatures needed for the primers in the third step. For VDS2 the temperature used was 55.6 C and for M13 the temperature was 42 C. One of the PCR machines was used for the first four samples and the other one for the other four samples.
PCR for pGBR22 (Trial 2) - 6/13/2013
This protocol was done for the second time since the results of the first one showed contamination. Primers SP6/T7 were used again. However, a different PCR machine was used.
Midi Prep - 6/12/2013
Figure 1: Nanodrop spectrometer reading for pGBR22 plasmid purified from E.coli (DH5-alpha) run 1.
Figure 2: Nanodrop spectrometer reading for pGBR22 plasmid purified from E.coli (DH5-alpha) run 2.
Agarose gel preparation for pGBR22 plasmid (Trial 1) - 6/11/2013
Figure 1: PCR of plasmid pGBR22 for the first time.
Lane 1: 1 kb Ladder Lane 2: Sample A, 1:500 template DNA, 1 uL Taq Lane 3: Sample B: 1:500 template DNA, 1 uL Taq Lane 4: Sample C: 1:50 template DNA, 1 uL Taq Lane 5: Sample D: no DNA, 1 uL Taq
Note: Samples showed contamination. Therefore, PCR must be redone.
WEEK 1
PCR for pGBR22 (Trial 1) - 6/7/2013
The primers used for this PCR were SP6/T7.
Transformation of competent cells for plasmid prep - 6/5/2013 to 6/7/2013
Figure 1: Transformation of E. coli cells with 1 ng pNIC-Bsa4 plasmid grown on LB+Amp Agar plates.
Figure 2: Transformation of E. coli cells with 5 ng pNIC-Bsa4 plasmid grown on LB+Amp Agar plates.
Figure 3: Transformation of E. coli cells with 25 ng pNIC-Bsa4 plasmid grown on LB+Amp Agar plates.
Nanodrop Spectrophotometer - 6/4/2013
Fig 1: First nanodrop analysis of pGBR22 (purple plasmid) in order to determine the purity and the concentration of the DNA plasmid.
Fig 2: Second nanodrop analysis of pGBR22 (purple plasmid) in order to determine the purity and the concentration of the DNA plasmid.
Week 13, 14 & 15
Inhibition assay - 12/6/2013
Enzyme assay - 12/5/2013
Characterization of YopH - 12/5/2013
Lane 1: SKIP
Lane 2: the molecular weight standard ladder
Lane 3: cell lysate before induction
Lane 4 : cell lysate after induction
Lane 5: soluble fraction
Lane 6: flow through sample
Lane 7: wash sample
Lane 8: elution 1
Lane 9: elution 2
Purification of YopH - 12/3/2013
The YopH enyme that was expressed was purified using the affinity tag and the Ni-NTA resin.Expression of YopH - 11/21/2013
The YopH enzyme was transformed into BL21(DE3) cells in order to be expressed.Weight of pellet: 1.47g
Measuring OD values - 23uL of total culture
Time Abs at 600nm
9:53 .086
10:29 .075
11:00 .099
12:09 .28
12:34 .36
12:46 .385
1:07 .47
1:12 .47
1:20 .52
From TbPP2A to YopH - 11/21/2013
After several attempts of cloning, a positive clone of Trypanosoma brucei PP2A was not obtained. As a result, we have to move towards the surrogate enzyme YopH. Expression, purification, and characterization will be done on this enzyme. In addition, different concentration of the YopH enzyme will be tested in enzyme assays.Week 11 & 12
Ligand Preparation - 11/14/2013
The protocol of Ligand preparation was completed in order to make the ligands ready to be screened. The CB-kit_UT.sdf library is currently being screened through GOLD on the homology model of T. brucei PP2A.
Blast Nucleotide Comparisons for Miniprep samples (fourth time) - 11/12/2013
After receiving the DNA sequences of the 18 samples sent to DNA sequencing, a blast nucleotide comparison was done. The two sequences compared were the one of T. Brucei PP2A with each of the the cloning attempts of Tb PP2A (eight samples). All of these blast comparisons showed no similarity. Most of these sequences contained a lot of N's and they were really short. In addition, an email from dfscore was received saying that there might be something wrong with the primers that were used. As a result, few of these samples will be sent again to DNA sequencing using other pLIC-forward and reverse primers in order to know if these are positive clones or not.DNA Sequencing - 11/8/2013
All the samples obtained from mini-prep, except number 9, were sent to DNA sequencing with pLIC-forward and pLIC-reverse
Mini Prep - 11/8/2013
Mini prep was done on the nine pellets obtained from the nine transformation tubes from the second master plate (the one with 3 ul accepting vecot & 5 ul of insert). Instructions for this step were done following the manual in the miniprep kit. All of the samples were eluted with 50 ul of water and the concentrations for these samples are shown below.Spin down samples - 11/7/2013
Samples were spun down at 6000 rpm for 10 minutes at 4 C. Supernatant was removed. Samples from the 9 tubes of the master plate containing colonies of 3 ul of accepting vector and 5 ul of insert will be used to do mini-prep. On the other hand, the pellets obtained from the transformation tubes of the plate with 2 ul of accepting vector and 4 ul of insert were stored at -20 C.Master plate - 11/5/2013
Two master plates were prepared with 9 colonies from each of the transformation plates done on 11/4/2013. The transformation tubes were also prepared. However, there was an error made on this step. Instead of adding 5 ml of LB and 5 ul of Kanamycin to each tube, 5 ml of LB and 5 ul of Ampicillin were added to each tube. As a result, no bacteria grew on the tubes, but it still grew on the master plates since it contained Kanamycin. The transformation tubes were prepared again using the colonies from the master plates.Plates were moved from 37C incubator to 4C fridge - 11/5/2013
The two plates of the annealing and the transformation step were on the 37 C incubator for a day. Then, they were moved to the 4 C fridge.Annealing and transformation - 11/4/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 4ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 5 ul of each T4-treated insert. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the plates were incubated upside down at 37 C for one day.Week 9 & 10
Jacky: Good job explaining the steps and analyzing! Keep up the good work! -Suman
Preparation of the ligands - 10/29/2013
Since it is best to protonate the ligands and generate alternative ionization and tautomeric states, the control ligands were prepared. These ligand preparation methods applied a Force Field to each atom and subsequently carried out an Energy Minimization process to put the ligand in a low energy conformation that is more probable as a starting point in solution. These ligands will then be used for docking our protein.Positive and negative controls for PP2A - 10/28/2013
11 positive controls were found through the literature of 2NPP, the PDB structure that was used to make our homology model, and through other PDB structures that are very similar to our target, Tb.PP2A. The negative controls were found using Chembridge website and similar properties as the known inhibitors of PP2A like microcystin.Transformation plates after being incubated at 37 C - 10/24/2013
As it is observed, the plates did not grow as clean of colonies as expected. In an effort to fix this situation, I decided to swipe some of the bacteria from each plate and spread it out on new plates (respectively), in order to regrow the bacteria in better looking colonies. However, one colony from the 2ul T4 treated accepting vector and the 8ul T4 treated insert was picked and chosen to make a master plate.
Annealing and transformation - 10/22/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 8ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 6 ul of each T4-treated insert. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the plates were incubated upside down at 37 C for two days since they did not show colonies the first day.Week 7 & 8
**Nice work Jacky. Very well organized and analyzed. Do you have any virtual data? -Max 10/21/13
pNIc-Bsa4 preparation as an accepting vector - 10/16/2013More pNIC-bsa4 was prepared as an accepting vector in order to do another round of cloning to find a positive clone of PP2A.
PCR clean up - 10/11/2013
PCR clean up was done in Secondary PCR sample 3 obtained on 8/30/2013. Another PCR clean up was done in all of the Secondary PCR samples from 8/30/2013. The Sigma PCR cleanup kit in red box was used for this procedure.Note: The concentration obtained from PCR clean up was really good. In addition, the 260/280 and 260/230 values are in the range expected, which shows that the purity of the sample is good. This PCR clean up sample will be used for cloning.
PCR Squared Reaction - 10/11/2013
Eight samples of PCR squared reaction were done using the secondary PCR. An agarose gel was run with these samples to verify that they worked correctly.Lane 1: SKIP
Lane 2: 100bp DNA ladder
Lane 3-10: PCR2 squared reaction
Secondary PCR thermocycler cycling conditions used:
98°C - 30 sec
98°C - 10 sec
70.1°C - 25 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Cloning did not work - 10/11/2013
After the plates were incubated upside down at 32 C for one day, there were no colonies in both plates. Therefore, the plates were incubated another day. However, there were still no colonies, and this shows that cloning did not work. As a result, more PCR squared reaction will be done using the same thermocycler conditions as before and then PCR clean up on these samples in order to go into cloning again.Annealing and Transformation - 10/10/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 8ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 10 ul of each T4-treated insert. More T4-treated insert was added to each tube since we had a low concentration of the PCR sample. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the plates were incubated upside down at 37 C for one day.Gel extraction on PCR squared reaction - 10/9/2013
A gel was run using all the samples from PCR squared reaction made on 10/4/2013. New TAE was used in order to prevent contamination. For this procedure, the gel was cut were the bands of the gene were shown and then the gel extraction kit was used to follow the procedure of the gel extraction protocol. There were several errors while adding the solutions to the gel and the procedure took longer than what it should take. After finishing this protocol, the concentration of the PCR sample was measured using a nanodrop spectrophotometer. The concentration was not as high as expected and this could be due to the errors made. A picture of the gel before it was cut and the nanodrop images are shown below.Lane 1: SKIP
Lane 2: 100bp DNA ladder
Lane 3-10: PCR2 squared reaction
Secondary PCR thermocycler cycling conditions used:
98°C - 30 sec
98°C - 10 sec
70.1°C - 25 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Positive and negative controls for virtual screening - 10/8/2013
Two positive and one negative control were found. They were run using the GOLD pogram in order to see which one has a higher score. The controls obtained are shown in the table below. However, we still need to find more controls in order to do another run with our protein.Week 5 & 6
**Nice Job with keeping your work up to date. Please try to add a more detailed description for your homology model. Thank you. -Max 10/07/2013
PCR Squared Reaction - 10/4/2013
Eight samples of PCR squared reaction were done using the new secondary PCR. This time, we will not use 15ul of these samples in an agarose gel to check if these reactions worked correctly. Instead, we will put all of the samples in the agarose gel and we will do gel extraction. This procedure will be done on Monday 10/7/2013. Then, we will continue with PCR clean up and with cloning to find a postive clone.Blast Nucleotide Comparisons for Miniprep samples (second time) - 10/4/2013
The eight samples obtained from the second miniprep that was done were sent to DNA sequencing. After receiving the DNA sequences, a blast nucleotide comparison was done. The two sequences compared were the one of T. Brucei PP2A with each of the the cloning attempts of Tb PP2A (eight samples). All of these blast comparisons showed no simmilarity; therefore, they cannot be used for the next step. Another round of cloning will be done and hopefully a positive clone can be found.Homology Model - 10/3/2013
A homology model was created since protein phosphatase 2A does not have one.Mini Prep - 9/27/2013
Mini prep was done on the eight pellets obtained from the eight transformation tubes from the second master plate. Instructions for this step were done following the manual in the miniprep kit. This time the samples were eluted with the right amount of water, 50 ul.Note: Most of these samples have really good concentrations and higher than expected; however, the 260/280 and 260/230 values are lower than the average. These values show that the samples are not pure and do not have a good yield.
Secondary PCR - 9/26/2013
Two samples of secondary PCR were done using the same thermocycler cycling conditions that were used the last time it worked.Lane 1-5: Tony's samples
Lane 5: SKIP
Lane 6: 100bp DNA ladder
Lane 7: primary PCR
Lane 8-9: Secondary PCRs (new tail primers)
Secondary PCR thermocycler cycling conditions used:
98°C - 30 sec
98°C - 10 sec
63°C - 25 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Blast Nucleotide Comparisons for Mini prep samples - 9/25/2013
The Blast nucleotide comparison for the DNA sequence of T. Brucei PP2A and the cloning attempt of Tb PP2A (sample 3) gave a 99% of query and a 98% of identity. These percentages are really good. However, since it has a deletion in base pair # 208, it cannot be used for the following step.
The Blast nucleotide comparison for the DNA sequence of T. Brucei PP2A and the cloning attempt of Tb PP2A (sample 5) gave a 89% of query and a 99% of identity. These percentages are really good. However, since it has two deletions, it cannot be used for the following step.
The Blast nucleotide comparison for the DNA sequence of T. Brucei PP2A and the cloning attempt of Tb PP2A (sample 7) gave a 93% of query and a 96% of identity. These percentages are really good. However, since it has two deletions, it cannot be used for the following step.
Note: Mini prep will be done again. This time we will use the tubes obtained from the other master plate that was done. In addition, more secondary PCR will be done in order to be prepared for another round of cloning in case this one does not give a positive clone.
Week 3 & 4
Jacky - good work on cloning for this 2 week block. Keep moving it foward though so that we can get your positive clones and move on to the next step. - Dr. B 100113DNA Sequencing - 9/20/2013
Samples of the miniprep done in tube 2, 3, 5, and 7 were sent to DNA sequencing.Mini Prep - 9/20/2013
Mini prep was done on the eight pellets obtained from the eight transformation tubes. Instructions for this step were done following the manual in the miniprep kit. However, in the elution step there was an error made. Instead of eluting with 50ul of water or 5mM Tris HCL pH 8.0, all of the samples were eluted with 100 ul of water. This error affected the concentrations of the samples.Spin down samples - 9/18/2013
Samples were spun down at 6000 rpm for 10 minutes at 4 C. Supernatant was removed and transformation tubes were stored at -20 C.Master plate - 9/17/2013
8 colonies from the transformation plate containing the transformation mixture of tube B were grown for about 18 hours in 5 ml of LB with 50 ug/ml Kanamacyn. In addition, a master plate using those colonies was done and incubated at 37 C overnight.Plates were moved from 37C incubator to 4C fridge - 9/15/2013
The two plates of the annealing and the transformation step were on the 37 C incubator for a day and a half. Then, they were moved to the 4 C fridge.Annealing and Transformation - 9/13/2013
The procedure for annealing and transformation was immediately done after finishing the cohesive ends of both the accepting vector and PCR insert. In this procedure, two transformation tubes were used. Tube A contained 2ul of T4-treated accepting vector with 4ul of each T4-treated insert. Tube B contained 3 of T4-treated accepting vector with 6ul of each T4-treated insert. 25 ul of competent cells (DH5a) were added to both tubes. Then, they were incubated on ice for 30 minutes. After this they were heat shocked for about 30 seconds in 42 C water bath. Then, 100 ul of pre-warmed SOC was added to each tube. Next, the tubes were shaked for 1 hour in 37 C shaker. After this, the transformation mixture was spread onto LB-Agar plates with 50 ug/ml Kanamacyn and 5% sucrose. Finally the tubes were incubated upside down at 37 C for about a day and a half.Preparation of pNIC-Bsa4 as Accepting Vector - 9/13/2013
The preparation of pNIC-Bsa4 as an accepting vector was done by Kevin.NOTE: After taking a picture without the rig, the strange imaging at the bottom of the gel disappeared.
PCR clean up - 9/13/2013
PCR clean up was done in Secondary PCR sample 3 obtained on 8/30/2013. Another PCR clean up was done in all of the Secondary PCR samples from 8/30/2013. The Sigma PCR cleanup kit in red box was used for this procedure.As it is observed in the graphs shown above, the concentration of the PCR clean up done on the PCR2 squared reaction was really low. Therefore, it cannot be used for the next step. However, the concentration of the PCR clean up of all the secondary PCRs samples was really high, which is really good. This sample will be used for the following step.
PCR squared reaction - 9/12/2013
PCR squared was done on Secondary PCR sample 3 obtained on 8/30/2013. The purpose of this step was to make a lot of PCR product since a lot of it will be lost in the PCR cleanup steps. The thermocycler cycling conditions used for this protocol were the same as in Secondary PCR. The only difference was the amount of cycles, which in this case was 30.Lane 1-2: SKIP
Lane 3: 100bp DNA ladder
Lane 4-7: PCR2 squared reaction
Secondary PCR thermocycler cycling conditions used:
98°C - 30 sec
98°C - 10 sec
70.1°C - 25 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Week 1 & 2
Jacky - need results here. Dr. B 090913PyMOL Refresher - 9/4/2013
In order to refresh basic technical and analytical skills of the PyMOL Program, four versions of DHFR were analyzed. Human DHFR was compared to T.cruzi DHFR. This comparison showed that the MTX active sites of both proteins are very similar. On the other hand, when the Human DHFR active site was compared to the T.cruzi TMQ active site, it was found that the two active sites are different. Therefore, the TMQ active site can be targeted specifically, while causing no inhibition of Human DHFR.
Secondary PCR - 8/30/2013
Lane 1: SKIP
Lane 2: 100bp DNA ladder
Lane 3-10: Secondary PCRs ( new tail primers)
Secondary PCR thermocycler cycling conditions used:
98°C - 30 sec
98°C - 10 sec
? - 25 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
? = Anneanling temperatures used at each lane:
Lane 1: 72°C
Lane 2: 71.4°C
Lane 3: 70.1°C
Lane 4: 68.3°C
Lane 5: 66°C
Lane 6: 64.3°C
Lane 7: 63°C
Lane 8: 62°C
New primers were ordered since the ones that were used during the summer were not order correctly.
Fall 2013
Week 6
Primary PCR and secondary PCR - 7/10/2013
Four samples of secondary PCR were done with the tail primers using different annealing temperatures and different times.Lane 1-2: SKIP
Lane 3: 100bp DNA ladder
Lane 4: Primary PCR
Lane 5-8: Secondary PCRs (tail primers)
Primary PCR thermocycler cycling conditions:
Same conditions as the ones used the first time.
Secondary PCR thermocycler cycling conditions (lane 5-6):
98°C - 30 sec
98°C - 10 sec
58°C - 25 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Secondary PCR thermocycler cycling conditions (lane 7-8):
98°C - 30 sec
98°C - 10 sec
63°C - 20 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Note: Primary PCR worked correctly. However, the secondary PCRs did not work.
Primary PCR and secondary PCR - 7/10/2013
Lane 1-2: SKIP
Lane 3: 1kb DNA ladder
Lane 4: Primary PCR
Lane 5: Secondary PCR (tail primers)
Lane 6: Secondary PCR (tail primers)
Primary PCR thermocycler cycling conditions:
Same conditions as the ones used the first time.
Secondary PCR thermocycler cycling conditions:
98°C - 30 sec
98°C - 10 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Note: Primary PCR worked correctly. However, both secondary PCRs did not work.
Primary PCR and secondary PCR - 7/9/2013
Another sample of Primary PCR was done using the same conditions as in 7/5/2013. In addition, two samples of secondary PCR were done at two different annealing temperatures using the tail primers.Week 5
Primary PCR and secondary PCR - 7/5/2013
Lane 4: 1kb DNA ladder
Lane 5: Primary PCR
Lane 6: Secondary PCR (first and last primers)
Primary PCR thermocycler cycling conditions:
98°C - 30 sec
98°C - 10 sec
58°C - 15 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Secondary PCR thermocycler cycling conditions:
98°C - 30 sec
98°C - 10 sec
58°C - 15 sec
72°C - 20 sec
72°C - 2 min
4°C - infinite
Note: Primary PCR seems to worked correctly since it looks like a smear. However, secondary PCR did not work correctly since the result observed is not in the place where it should be. First and last primers were used. The 100bp ladder should be used instead of the 1kb DNA ladder since the gene is 969 base pairs.
Agarose gel preparation for pLIC (Trial 1) - 7/3/2013
Lane 1: 100 bp DNA ladder
Lane 2: Low concentration sample (0.0362 ng/ul)
Lane 3: Medium concentration sample (0.362 ng/ul)
Lane 4: High concentration sample (3.62 ng/ul)
Lane 5: Control sample (no DNA)
Lane 6: Anita's samples
Note: Results shown are correct. Since the 4th lane has a higher concentration, it was expected that it has more amplification and a stronger signal than the other samples.
Restriction Enzyme Digest - 7/3/13
Lane 1: skip
Lane 2: 1 kb DNA ladder
Lane 3: Uncut plasmid sample
Lane 4: EcoRI
Lane 5: PvuII
Lane 6: EcoRI & PvuII
Note: This protocol was done for the second time. Digestion reactions were made on 7/2/13 and the agarose gel was done on 7/3/13. The results obtained match the results from the custom digest. However, there are other bands shown, which could be contamination.
Protein characterization for FtHAP - 7/2/2013
Lane 1: SKIP
Lane 2: Elution 2
Lane 3: Elution 1
Lane 4: Wash
Lane 5: Flow through
Lane 6: Soluble fraction
Lane 7: Cell lysate after induction
Lane 8: Cell lysate before induction
Lane 9: Molecular weight standard ladder
PCR for pLIC (Trial 1) - 7/2/2013
This protocol was done for the first time. The pNIC plasmid used had a concentration of 36.2 ng/ul. Four samples were prepared. The first one had a concentration of 0.0362 ng/ul. The second one had a concentration of 0.362 ng/ul. The third sample had a concentration of 3.62 ng/ul. The fourth sample did not have the DNA plasmid because it was the control. It is expected that sample 3 shows more amplification since it has the highest concentration.WEEK 4
Restriction Enzyme Digest - 6/28/2013
DIgestion reactions were made, but the gel will be done on Monday. Digestions are stored in the -20 C freezer.Lane 1: skip
Lane 2: 1 kb DNA ladder
Lane 3: Uncut plasmid sample
Lane 4: EcoRI
Lane 5: PvuII
Lane 6: EcoRI & PvuII
Lane 7-10: Kevin's samples
Note: Samples were done on 6/28/13, but the gel was done on 7/2/13. Digestion reactions were stored in -20C freezer. Samples did not show up; therefore, protocol has to be redone. The problem seems to be in the pGBR22 plasmid that was used since it did not work for anyone.
Protein Characterization - 6/28/2013
Gel is being washed over the weekend. On Monday, a picture of the gel will be taken and the gel will be dried.Protein Purification - 6/26/2013
Agarose gel preparation for pGBR22 plasmid (Trial 3) - 6/26/2013
Lane 1-5: Kavya's samples for pLIC
Lane 6: 1 kb Ladder
Lane 7: Sample A, 1:500 template DNA, 1 uL Taq
Lane 8: Sample B: 1:500 template DNA, 1 uL Taq
Lane 9: Sample C: 1:50 template DNA, 1 uL Taq
Lane 10: Sample D: no DNA, 1 uL Taq
Agarose gel preparation for GFP plasmid (Trial 2) - 6/26/2013
Lane 1: 100 bp ladder
Lane 2: sample 1, 1:100000 template DNA, 1 uL Taq
Lane 3: sample 2, 1:10000 template DNA, 1 ul Taq
Lane 4: sample 3, 1:1000 template DNA, 1 ul Taq
Lane 5: sample 4, no DNA, 1 ul Taq
Lane 6: 100 bp ladder
Lane 7: sample 5, 1:100000 template DNA, 1 uL Taq
Lane 8: sample 6, 1:10000 template DNA, 1 ul Taq
Lane 9: sample 7, 1:1000 template DNA, 1 ul Taq
Lane 10: sample 8, no DNA, 1 ul Taq
Note: The samples with the primers VDS 1 and 2 did not show any results. The only sources of error are in the temperature used or the PCR machine used since the Taq, buffer, and dNTP were the same ones used for the M13 forward and reverse primers, which showed up on the gel.
Analysis of DNA sequencing of pGBR22 - 6/24/2013
DNA sequence of pGBR22 was analyzed in the computer lab. The forward and reverse primers were determined, as well as the location of the start and stop codon of the specified plasmid and the vector backbone.WEEK 3
PCR for GFP (Trial 2) - 6/20/2013
This protocol was done for the second time since the first one did not show anything. The primers VDS1 and VDS2 were used for samples 1 through 4 and primers M13 forward and reverse were used for samples 5 through 8. Two PCR machines were used due to the different temperatures needed for the primers in the third step. For VDS2 the temperature used was 53.6 C instead of 55.6 C and for M13 the temperature was 42 C again. One of the PCR machines was used for the first four samples and the other one for the other four samples.PCR for pGBR22 (Trial 3) - 6/20/2013
This protocol was done for the third time since the results of the first two trials did not work correctly. This time, the primers used were M13 forward and reverse instead of SP6/T7. Also, a different PCR machine was used.Protein Expression - 6/17/2013 to 6/19/2013
Day 1: Transformation of FtHAP plasmid into BL21(DE3) cells.Day 2: Overnight cultures.
Day 3: Purification of the FtHAP protein.
Agarose gel preparation for GFP plasmid (Trial 1) - 6/18/2013
Lane 1: 100 bp ladderLane 2: sample 1, 1:100000 template DNA, 1 uL TaqLane 3: sample 2, 1:10000 template DNA, 1 ul TaqLane 4: sample 3, 1:1000 template DNA, 1 ul TaqLane 5: sample 4, no DNA, 1 ul TaqLane 6: 100 bp ladderLane 7: sample 5, 1:100000 template DNA, 1 uL TaqLane 8: sample 6, 1:10000 template DNA, 1 ul TaqLane 9: sample 7, 1:1000 template DNA, 1 ul TaqLane 10: sample 8, no DNA, 1 ul Taq
Note: Samples were not shown. Therefore, PCR must be redone.
Agarose gel preparation for pGBR22 plasmid (Trial 2) - 6/18/2013
Lane 1: 1 kb Ladder
Lane 2: Sample A, 1:500 template DNA, 1 uL Taq
Lane 3: Sample B: 1:500 template DNA, 1 uL Taq
Lane 4: Sample C: 1:50 template DNA, 1 uL Taq
Lane 5: Sample D: no DNA, 1 uL Taq
Lane 6-10: Karuna's samples for pGBR22
Note: Samples were not shown. Therefore, PCR must be redone.
DNA Sequencing results for pGBR22 (Midi prep) - 6/17/2013
NNNNNNNNNNNNNNNNNNNNNATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCG
CGGGATTTTAGTGATGGTGATGGTGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCAC
ACTGCTCAACAAATGTGTAATCCTTGTTGTGACTGGTTACATCCAGTTTGCGGTCAACATAGTG
ATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGTAAGTAGATTTGAATTCACACAAATAGTAA
CCACCTCCTTCCAACTTCAGAGCCATAAAGTTGTTTCCTATCAGCATTCCATCTCGTGCAAAG
AGACGCTCAGTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGG
AAAGTTCACACCAGAGATTTTGACATTGTAGATGAAACAGTTGCCTTGGATGCTGGAATCATTG
CTGACAGTACACACTGCACCATCTTCAAAGTTCATGATCCTCTCCCATGTATATCCCTCAGGGA
ATGACTGCTTTACATAATCAGGGATGTCTTCAGGGTACTTGGTGAATGGTATGCTTCCGTATTGA
GACAGTGGTGATAAAATATCCCAAGCAAATGGCAGAGGTCCACCCTTGGTGACAGTGAGCTTTA
CCGTCTGCTCCCCCTCGTAAGGCTTTCCTTTTCCATCGCCTTCGACCTCAAAGTAGTGTCCAT
TGACCGTGCCTGACATATAAACCTTGTAGGTCATTTGTTTAGCGATCACACTCATGATATTTCTC
CTTCAATCAATCAAAATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCNA
CGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGNNTGGCGTAATCATGGTCAT
AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCNCACAACATACGAGCCGGAAGCATA
AAGTGTAAAGCCTGGGGNGNCTAATGAGTGAGCTAACTCACNNTAANTGCGTTNNNCTNNCTGC
CCGCTTTCCANTCNGGNANNNGTCGNNNNNCNGCATNATGANCNGCNNNCNCNGGGNNNNGN
GTTNGCGTNNTNNNNCNNNTNCNNTNNNNNTNANNNANNNNNNNNNNNNNNNNNGNNNNNNNNN
NNNNNNNNNNNNNNNNNNANNNNNGNNNNNNNNNNNNNNNANNNNNNNNNNGNNANNNTNNNNC
ANGNNNNNNNNNNNNNNNNNNNNNNNNNNN
Blast Results for above sequence:
Note: The blast result shown above showed the identity of the pGBR22 plasmid. Therefore, the plasmid was transferred to the plasmid box.
WEEK 2 - Jacky - good job on the page. I would re-run your PCR of pGBR22. Looks like there are multiple amplification products. -- Dr. B
PCR for GFP (Trial 1) - 6/13/2013
This protocol was done for the first time. The primers VDS1 and VDS2 were used for samples 1 through 4 and primers M13 forward and reverse were used for samples 5 through 8. Two PCR machines were used due to the different temperatures needed for the primers in the third step. For VDS2 the temperature used was 55.6 C and for M13 the temperature was 42 C. One of the PCR machines was used for the first four samples and the other one for the other four samples.PCR for pGBR22 (Trial 2) - 6/13/2013
This protocol was done for the second time since the results of the first one showed contamination. Primers SP6/T7 were used again. However, a different PCR machine was used.
Midi Prep - 6/12/2013Agarose gel preparation for pGBR22 plasmid (Trial 1) - 6/11/2013
Lane 1: 1 kb Ladder
Lane 2: Sample A, 1:500 template DNA, 1 uL Taq
Lane 3: Sample B: 1:500 template DNA, 1 uL Taq
Lane 4: Sample C: 1:50 template DNA, 1 uL Taq
Lane 5: Sample D: no DNA, 1 uL Taq
Note: Samples showed contamination. Therefore, PCR must be redone.
WEEK 1
PCR for pGBR22 (Trial 1) - 6/7/2013
The primers used for this PCR were SP6/T7.Transformation of competent cells for plasmid prep - 6/5/2013 to 6/7/2013
Nanodrop Spectrophotometer - 6/4/2013DNA Sequencing - 6/3/2013
DNA plasmid: pGBR22
DNA sequence:
NNNNNNNNNNNNGGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTTTAGTGATGG
TGATGGTGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACAAATGTGTAATCCTTGTTGT
GACTGGTTACATCCAGTTTGCGGTCAACATAGTGATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGTAAGTAGAT
TTGAATTCACACAAATAGTAACCACCTCCTTCCAACTTCAGAGCCATAAAGTTGTTTCCTATCAGCATTCCATCTCGT
GCAAAGAGACGCTCAGTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGGAAAGTTCA
CACCAGAGATTTTGACATTGTAGATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGACAGTACACACTGCACC
ATCTTCAAAGTTCATGATCCTCTCCCATGTATATCCCTCAGGGAATGACTGCTTTACATAATCAGGGATGTCTTCAG
GGTACTTGGTGAATGGTATGCTTCCGTATTGAGACAGTGGTGATAAAATATCCCAAGCAAATGGCAGAGGTCCAC
CCTTGGTGACAGTGAGCTTTACCGTCTGCTCCCCCTCGTAAGGCTTTCCTTTTCCATCGCCTTCGACCTCAAAGTAGT
GTCCATTGACCGTGCCTGACATATAAACCTTGTAGGTCATTTGTTTAGCGATCACACTCATGATATTTCTCCTTCAAT
CAATCAAAATCACTAGTGCGGCCGCCTGCANGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTT
GAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC
TCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCA
CATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTNGGAAANCTGTCGTGCCAGCTGCANNNNANCGNCANNN
NNNGGGNNANNNGNTTGCGTNTGGGCGCTCNTCNNNNCCTCNNTCANNGACTCNNTGCNNNTNGNNCNNNG
NNNNNGNNNNNNNNTCNNNNNNNNNTNNANGNGNANTNNNNNNNNCNNNANCNGNNNNANNCNNNNN
NANNNNNNNNNNNNNNNNNANNNNNNNANCNNAANNNCNNNNNTNNNNNNNNTTTNNCNNNNNNNNN